QCM et exercices rédactionnels (école du CEERRF, Paris)

-----------------------------------------------

Énoncé

Première question : QCM
Pour chacune des propositions, retenez la (ou les) lettre(s) correspondant à la réponse exacte.
1. Une enzyme :
a. catalyse de manière spécifique un seul type de réaction chimique.
b. présente une capacité de catalyse liée à sa forme spatiale.
c. présente une double spécificité : spécificité de substrat et spécificité d'action.
d. peut être indirectement responsable de la réalisation d'un phénotype.
e. fournit l'énergie à la réaction qu'elle catalyse.
2. À une température de cent degrés Celsius, les enzymes humaines sont :
a. inactivées.
b. dénaturées.
c. détruites.
d. modifiées de façon irréversible.
e. beaucoup moins actives.
3. Une protéine :
a. réalise une fonction biologique précise.
b. est toujours une enzyme.
c. est un polynucléotide.
d. contient toujours tous les acides aminés de la nature.
e. peut être un biocatalyseur.
4. Une molécule d'ARNm :
a. est une cellule formée d'un seul brin de nucléotides.
b. est synthétisée dans le noyau des cellules eucaryotes.
c. a une durée de vie très brève.
d. comporte les mêmes constituants que l'ADN.
e. permet la synthèse de nombreuses copies identiques d'une même protéine.
f. est constituée d'une succession de nucléotides de quatre types possibles : A, T, C, G.
5. La transcription :
a. consiste à copier une information codée par l'ADN en une information codée sous forme d'ARNm.
b. est catalysée par l'ADN/polymérase.
c. se déroule dans le noyau de toutes les cellules vivantes.
d. débute par l'ouverture de la double hélice d'ARN.
e. permet la synthèse d'un brin d'ARNm à partir du brin transcrit de l'ADN par complémentarité des nucléotides.
6. Le diabète de type 1 :
a. est appelé diabète juvénile.
b. est insulinodépendant.
c. est dû à la destruction des cellules alpha du pancréas.
d. se caractérise par l'absence de sécrétion d'insuline.
e. s'accompagne d'une obésité.
f. est le moins fréquent des diabètes.
7. La section de la racine ventrale d'un nerf rachidien :
a. entraîne la paralysie des muscles innervés par ces fibres.
b. entraîne la suppression de la sensibilité des muscles innervés par ces fibres.
c. n'entraîne pas la paralysie des muscles innervés par ces fibres.
d. n'entraîne pas la perte de la sensibilité des muscles innervés par ces fibres.
e. entraîne la paralysie des muscles antagonistes aux muscles innervés par ces fibres.
8. Un message nerveux :
a. est constitué de trains de potentiels d'action.
b. est codé en amplitude de potentiels d'action.
c. est codé en modulation de fréquence de potentiels d'action.
d. est toujours transmis dans un seul sens dans le cas de la stimulation d'une fibre isolée.
e. est transformé en un message chimique au niveau d'une synapse.
f. se propage à la vitesse d'un courant électrique.
9. La duplication de l'ADN :
a. s'effectue toujours avant une division cellulaire.
b. est un mécanisme semi-conservatif.
c. est catalysée par une enzyme : l'ADN polymérase.
d. conduit à la formation de molécules d'ADN identiques entre elles.
e. peut être observée au microscope électronique.
f.  permet la formation de chromosome à une chromatide.
10. La mitose :
a. est un processus continu.
b. est divisée en cinq phases dont la cytodiérèse.
c. débute par l'anaphase.
d. conduit à la formation de deux cellules filles toujours diploïdes.
e. est parfois précédée d'une duplication de l'ADN.
11. Le VIH
a. est un rétrovirus.
b. se multiplie dans les cellules possédant le marqueur T4 encore appelé CD4.
c. possède la transcriptase inverse.
d. est un parasite obligatoire intracellulaire.
e. est responsable d'une immunodéficience.
12. Les anticorps membranaires :
a. sont présents sur la membrane des lymphocytes B avant introduction de l'antigène dans l'organisme.
b. sont présents sur la membrane des lymphocytes T4 et T8.
c. sont présents sur la membrane des lymphocytes B et des hématies.
d. sont présents sur la membrane des lymphocytes T avant introduction de l'antigène dans l'organisme.
e. ne sont présents sur la membrane des lymphocytes B qu'après l'introduction de l'antigène dans l'organisme.
f. ne sont présents sur la membrane des lymphocytes T qu'après l'introduction de l'antigène dans l'organisme.
13. Imaginons une cellule diploïde bloquée en métaphase 1. Il y aura dans cette cellule :
a. moins d'ADN que dans une cellule bloquée en métaphase de mitose.
b. plus d'ADN que dans une cellule bloquée en métaphase de mitose.
c. autant d'ADN que dans une cellule bloquée en métaphase de mitose.
Imaginons maintenant la même cellule bloquée en prophase 1. II y aura dans cette cellule :
d. moins d'ADN que dans une cellule bloquée en fin de phase G2 de son cycle cellulaire.
e. plus d'ADN que dans une cellule bloquée en fin de phase G2 de son cycle cellulaire.
f.  autant d'ADN que dans une cellule bloquée en fin de phase G2 de son cycle cellulaire.
14. Un test-cross :
a. est le produit d'un croisement entre un hétérozygote Fl et un double récessif.
b. est le produit d'un croisement entre deux individus Fl.
c. présente une répartition en 16e dans le cas de deux gènes liés.
d. donne une répartition (\frac{3}{4}, \frac{1}{4}) dans la transmission d'un gène à codominance.
e. présente une répartition en 16e dans le cas de deux gènes indépendants.
15. Chez la femme, le second globule polaire possède :
a. toujours un chromosome X quand la méiose se déroule bien.
b. jamais de chromosome Y.
c. autant d'ADN que le premier globule polaire.
d. deux fois moins d'ADN que le premier globule polaire.
e. 223 chromatides.
f.  autant d'ADN qu'un spermatozoïde.
16. Chez la femme :
a. en début de cycle sexuel, l'endomètre présente un aspect caractéristique qualifié de dentelle utérine.
b. l'épaisseur de l'endomètre est plus importante vers le 20e jour du cycle que vers le 10e jour de ce même cycle.
c. les glandes de la muqueuse utérine peuvent sécréter du gIycogène et du mucus.
d. l'utérus d'une femme ménopausée continue de subir des modifications physiologiques sous l'action des hormones ovariennes.
e. le myomètre double d'épaisseur entre le début du cycle menstruel et la fin de ce même cycle.
f. Ie cycle menstruel débute le premier jour des règles et se termine la veille des règles suivantes.
17. La jument a 60 chromosomes alors que l'âne en possède 66. La mule est issue de leur croisement. Le nombre de bivalents au maximum pouvant se former en prophase 1 chez la mule est de :
a. 126.
b. 30.
c. 66.
d. 252.
e. 60.
18. Les premiers outils de pierre taillée :
a. correspondent à une industrie dite oldowayenne.
b. correspondent à l'arrivée d'Homo erectus.
c. sont des bifaces.
d. correspondent à une industrie dite proustérienne.
e. correspondent à une industrie dite moustérienne.
f. datent d'environ 2 millions d'années.
19. Les rites funéraires :
a. apparaissent avec les Néandertaliens.
b. datent de 300 000 ans environ.
c. témoignent d'une croyance à une vie dans l'au-delà.
d. ne sont pas contemporains du début de la maîtrise du feu.
e. sont contemporains des premiers bifaces.
f. ont pu être célébrés à la mort de Cro-Magnon.
20. Le tableau ci-dessous permet d'affirmer que :
a. la lamproie et la truite sont les organismes qui ont, ici, la parenté la plus étroite.
b. les doigts constituent un caractère utilisé pour préciser les parentés entre ces organismes.
c. le pigeon et le chien sont les organismes qui ont, ici, la parenté la plus étroite.
d. le placenta constitue un caractère utilisé pour préciser les parentés entre ces organismes.
e. le lézard et le pigeon sont les organismes qui ont, ici, la parenté la plus étroite.
 
Lamproie
Lézard
Pigeon
Chien
Truite
Amnios
A
P
P
P
A
Placenta
A
A
A
P
A
Doigts
A
P
P
P
A
Gésier
A
P
P
A
A

A : caractère absent.
P : caractère présent
Deuxième question
L'AMH, lors de la vie fœtale, a pour cible les canaux de Müller dont elle entraîne la disparition chez les fœtus mâles, mais elle agit aussi sur les cellules interstitielles des testicules. On constate d'autre part que des souris mâles transgéniques produisant de l'AMH en grande quantité présentent un appareil génital atrophié.
1. Que signifie « appareil génital atrophié » ?
2. Dans le cadre d'un développement normal, comment est assurée l'obtention d'un phénotype masculin ?
3. D'après l'énoncé, qu'est-ce qui est à l'origine de cet appareil atrophié chez les souris ?
La synthèse de testostérone à partir du cholestérol s'effectue dans les cellules interstitielles. Le cholestérol est d'abord transporté par une protéine StAR, puis rentre dans une chaîne de biosynthèse dans laquelle interviennent différentes enzymes dont E1, E2, et E3.
Le graphique ci-dessous traduit les résultats du dosage de ces quatre molécules chez des souris mâles transgéniques.
Quantités moyennes des protéines étudiées, produites par les souris transgéniques, en % par rapport à des souris témoins (non transgéniques) :
4. Globalement, que peut-on dire de la production des protéines dont il est question chez les souris transgéniques par rapport à celle existant chez des souris normales ?
5. D'après le rôle de ces protéines, quelle sera la conséquence de cette production ? Justifier alors le fait que l'appareil soit atrophié.
6. Émettre une hypothèse sur le mode d'action de l'AMH en grande quantité au niveau des cellules interstitielles.
Troisième question
1. Les hématies de l'homme sont dépourvues de noyau lorsqu'elles se trouvent dans le sang. Elles proviennent d'érythroblastes qui perdent leur noyau. Les érythroblastes réalisent la synthèse d'hémoglobine. Après la perte du noyau, ces cellules continuent, pendant un temps très court, à synthétiser de l'hémoglobine. Dans les hématies, il n'y a pas de synthèse d'hémoglobine.
a. Quel rôle du noyau est mis en évidence par ces observations ?
b. Quelles molécules permet la synthèse d'hémoglobine lorsque l'érythroblaste a perdu son noyau ? Présentez brièvement sa structure.
2. Un des brins du fragment d'ADN contenant une portion de la phase codante du gène permettant la synthèse de la chaîne bêta de l'hémoglobine a été isolé. Sa séquence est la suivante :
GTATGGTGCACCTGACTCCTGAGGAGAAGTCTGCGGTTACTGCC
a. Localisez le début de la séquence de la portion du gène responsable de la synthèse de l'hémoglobine. Justifiez votre réponse.
b. Écrire la séquence nucléotidique du fragment d'ARNm codant pour le début de la chaîne bêta de l'hémoglobine. Justifiez votre réponse.
c. Déterminez le début de la séquence de la chaîne bêta.
d. On a isolé une chaíne béta dans laquelle la sérine est remplacée par une tyrosine. Indiquez, en justifiant votre réponse, quelles sont les mutations a l'origine de cette nouvelle séquence.
e. On a également isolé une forme écourtée de la chaîne bêta : seuls les deux premiers acides aminés sont présents. Déterminez la mutation à l'origine de cette chaîne.
f.  À quel moment du cycle cellulaire et au niveau de quelles cellules ces mutations ont-elles eu lieu ?
Code génétique :

Corrigé

Première question : QCM
1. Réponses : a, b, c, d.
Commentaires
b. La réaction chimique ne peut se faire que lors de la liaison enzyme-substrat. La complémentarité de forme entre le site actif de l'enzyme et une portion de la molécule de substrat est indispensable.
d. En permettant la production d'un composé chimique particulier dans une cellule, une enzyme participe à la réalisation du phénotype.
2. Réponses : b, d.
Commentaires
a. Les enzymes deviennent inactives lorsqu'elles se trouvent à des températures trop basses.
b. À cette température, les enzymes, qui sont des protéines, perdent leur conformation spatiale.
e. Chaque enzyme présente une température optimale d'activité. Quand les températures diffèrent de cette valeur, même si elles en sont proches, les enzymes sont beaucoup moins actives.
3. Réponses : a, e.
Commentaire
e. Bien que de nombreuses protéines soient des enzymes, elles ne sont pas toutes de cette nature.
4. Réponses : b, c, e.
Commentaires
a. L'ARNm est une molécule, pas une cellule.
d. Dans l'ARNm, la base azotée T n'existe pas. Elle est remplacée par U.
5. Réponses : a, e.
Commentaires
c. Certaines cellules vivantes n'ont pas de noyau (ex. : les bactéries). Dans ce cas, la transcription a lieu dans le cytoplasme.
d. L'ARNm est une molécule monobrin, c'est-à-dire formée d'une seule chaîne de nucléotides. Il n'y a pas d'ouverture possible.
6. Réponses : a, b, d, f.
Commentaires
d. Les cellules β du pancréas sont totalement détruites par une réaction auto-immune. Le système immunitaire présente un dysfonctionnement et détruit les cellules de l'organisme lui-même.
f. Le diabète de type I est le plus grave des diabètes, mais aussi le plus rare. Il touche 1 personne sur 1 000 en France et représente 10 % des cas de diabète.
7. Réponses : a, d, e.
Commentaire
e. Les fibres motrices du circuit inhibiteur passent également dans la racine ventrale du nerf rachidien.
8. Réponses : a, c, e.
Commentaires
d. Sur une fibre isolée, le message est transmis dans les deux sens. C'est le fonctionnement polarisé de la synapse qui impose un sens unique de propagation.
f. Le message nerveux est beaucoup plus lent qu'un courant électrique. Il correspond à des échanges ioniques de part et d'autre de la membrane de la fibre nerveuse.
9. Réponses : a, b, c, d, e.
Commentaires
b. Les deux brins de la molécule d'ADN se séparent et chaque brin sert de modèle pour la reconstitution d'un brin complémentaire. Les deux nouvelles molécules contiennent donc la moitié de la molécule initiale, d'où le terme de duplication semi-conservative.
f. Le chromosome obtenu après duplication de l'ADN comporte deux chromatides.
10. Réponses : a, b.
Commentaires
b. La cytodiérèse ou division du cytoplasme débute dès l'anaphase et s'achève en télophase. Elle complète la division du noyau.
d. La mitose d'une cellule haploïde donne deux cellules haploïdes.
e. La mitose est toujours précédée d'une duplication d'ADN.
11. Réponses : a, c, d, e.
Commentaires
b. La synthèse de nouvelles protéines virales se fait dans les LT4, mais leur assemblage en nouvelles particules virales s'effectue lors de leur expulsion hors de la cellule par bourgeonnement. Les nouveaux virus apparaissent alors dans le milieu extracellulaire.
e. En détruisant les LT4, le VIH provoque une diminution des réactions immunitaires, les LT4 étant à l'origine de la stimulation des LB et des LT8.
12. Bonne réponse : a.
Commentaires
a. Il existe dans l'organisme des clones de LB qui diffèrent les uns des autres par les anticorps membranaires qu'ils portent. Ces clones existent dans l'organisme avant l'introduction de tout élément étranger.
b. Les LT4 et LT8 portent des récepteurs membranaires, mais dont la structure est différente de celle des anticorps.
13. Réponses : c, f.
Commentaires
c  Le début d'une division 1 de méiose est identique à celui d'une mitose en ce qui concerne les quantités d'ADN (l'ADN est répliqué ; les chromosomes homologues ou les chromatides ne sont pas encore séparés).
f. En fin de phase G2, l'ADN est dupliqué : les chromosomes sont alors constitués de deux chromatides. Lors de la prophase 1 qui suit la phase G2, on assiste seulement à une individualisation des chromosomes à 2 chromatides.
14. Bonne réponse : a.
Commentaires
c. Après crossing-over entre les deux gènes liés, l'individu hétérozygote fournit 4 types de gamètes. Le résultat du test-cross montrera 4 types de descendants. La répartition est donc en quart (\frac{x}{4}).
d. Ce résultat est celui obtenu dans le cas d'une F2 issue d'un croisement entre deux F1 hétérozygotes pour un gène.
15. Réponses : a, b, d, f.
Commentaires
a. Dans un globule polaire issu de la 2e division de la méiose, on trouve un représentant de chaque type de chromosome, en particulier un chromosome sexuel x (puisqu'il s'agit de sexe femelle).
c. Le 2e globule polaire est issu de la 2e division de la méiose. Ses chromosomes sont à 1 chromatide, alors que le 1er globule polaire résulte de la 1re division de la méiose. Ses chromosomes sont encore à 2 chromatides. C'est donc l'affirmation d. qui est vraie.
f. Les cellules obtenues à la fin de la méiose dans les deux sexes ont le même nombre de chromosomes. Elles sont haploïdes, à 23 chromosomes.
16. Réponses : b, c, f.
Commentaires
d. Chez une femme ménopausée, il n'y a pas plus de sécrétions ovariennes.
e. L'épaisseur de l'endomètre passe en moyenne de 0,5 à 5 mm au cours d'un cycle. Elle est donc multipliée par 10.
17. Bonne réponse : b.
Commentaire
b. L'ovule de jument contient 30 chromosomes. Le spermatozoïde d'âne en contient 33. Dans une cellule de mule, il y a donc 30 paires de chromosomes 2 à 2 identiques et 3 chromosomes non appariés, soit 30 bivalents en prophase I de méiose.
18. Réponses : a, f.
19. Bonne réponse : a.
20. Réponses : c, d, f.
Commentaires
b. L'apparition de l'homme de Néandertal est datée de -110 000 ans. Les rites funéraires ne peuvent donc pas dater de 300 000 ans avant J.-C.
d. La maîtrise du feu est apparue avec l'homo erectus. Les rites funéraires pratiqués par les néandertaliens sont postérieurs.
f. L'homo sapiens et l'homme de Néandertal ont cohabité jusqu'à -30 000 ans environ. L'affirmation est donc vraie.
21. Réponses : b, d, e.
Commentaire
e. Ces deux espèces sont les seules à partager la présence simultanée de trois caractères (amnios, doigts et gésier).
Deuxième question
1. Un appareil génital atrophié est un appareil dont les organes sont incomplètement développés.
2. L'obtention d'un phénotype masculin est le résultat d'une double évolution :
  • l'évolution de la gonade indifférenciée en testicule sous l'effet de la protéine TDF codé par le gène SRY du chromosome Y ;
  • l'évolution des voies génitales dans le sens mâle grâce à 2 hormones : la testostérone (qui empêche la régression des canaux de Wolff et masculinise les organes génitaux externes) et l'AMH ou hormone antimüllérienne (qui est responsable de la régression des canaux de Müller).
3. L'atrophie provient d'un excès d'AMH, ayant pour conséquence une régression des cellules intersticielles du testicule et un déficit de sécrétion de testostérone. Les canaux de Wolff régressent en partie.
4. La production des protéines StAR, E1, E2, E3 chez les souris transgéniques est inférieure à la quantité produite chez des souris normales.
5. Cette production insuffisante a pour conséquence un déficit en testostérone, la chaîne de biosynthèse fonctionnant moins efficacement. La moindre production de testostérone engendre une régression partielle des canaux de Wolff ainsi que leur atrophie, par rapport à un sujet normal.
6. On peut émettre l'hypothèse que l'AMH inhibe la synthèse protéique dans les cellules intersticielles, par exemple en agissant directement au niveau de l'ADN.
Troisième question
1. a. Le noyau contient l'information génétique nécessaire à la synthèse de l'hémoglobine.
b. Il s'agit de molécules d'ARN messager ou ARNm. Une molécule d'ARNm est une chaîne simple de nucléotides formée par complémentarité sur un fragment de brin d'ADN. Les nucléotides présents sur l'ARNm sont A, U, C, G.
2. a. Le ribosome commence la lecture de l'ARNm au niveau d'un codon AUG, dit codon initiateur, soit un triplet TAC sur le brin transcrit d'ADN. Le brin proposé ne possède pas cette séquence. Il représente donc le brin complémentaire du brin transcrit, sur lequel il faut rechercher le triplet complémentaire de TAC, c'est-à-dire ATG. Ce triplet correspond au 2e triplet de la séquence proposée.
b. La séquence recherchée est la même que la séquence proposée (brin non transcrit), à ceci près qu'il faut remplacer les T par des U et commencer par le codon initiateur : GGU AUG GUG CAC CUG ACU CCU GAG GAG AAG UCU GCG GAA ACU GCC.
c. Voici le début de la séquence de la chaîne β :
Met - Val - His - Leu - Thr - Pro - Glu - Glu - Lys - Ser - Ala - Val - Thr - Ala
d. Le codon UCU correspondant à la sérine est devenu l'un des deux codons UAU ou UAC correspondant à la tyrosine.
Dans le 1er cas (UCU devient UAU), il y a eu une substitution d'un nucléotide (C en A).
Dans le 2e cas (UCU devient UAC), il y a eu une double substitution de nucléotides (C en A puis U en C).
e. Cela signifie que le 3e codon (après le codon initiateur) CUG, est devenu un codon stop, par exemple UAG, par une double substitution de C en U et de U an A.
f. Les mutations ont lieu au moment de la réplication de l'ADN, pendant la phase S de l'interphase. Elles peuvent se produire dans les érythroblastes qui sont les cellules responsables de la synthèse d'hémoglobine. Celle-ci affecte alors uniquement l'individu qui a subi la mutation (mutation d'une cellule somatique).
S'il s'agit d'une anomalie héréditaire (transmise par un des parents), les mutations en question se sont produites dans l'une des cellules de la lignée germinale (spermatogonie I ou ovocyte I), aboutissant à la formation des gamètes.
------------------------------------------------------------
copyright © 2006-2017, rue des écoles